|
DNASTAR
megalign Megalign, supplied by DNASTAR, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+star+software+package+lasergene/pm39794745-59-1-7?v=DNASTAR Average 99 stars, based on 1 article reviews
megalign - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
DNASTAR
megaalign software lasergene ![]() Megaalign Software Lasergene, supplied by DNASTAR, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+star+software+package+lasergene/pmc10359356-105-5-7?v=DNASTAR Average 99 stars, based on 1 article reviews
megaalign software lasergene - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
GraphPad Software Inc
graphpad prism 7 ![]() Graphpad Prism 7, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+star+software+package+lasergene/pm31079916-285-235-235?v=GraphPad+Software+Inc Average 90 stars, based on 1 article reviews
graphpad prism 7 - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Addgene inc
crispr cas9 genomic engineering idt star methods rbns primers idt star methods recombinant dna px458 addgene plasmid ![]() Crispr Cas9 Genomic Engineering Idt Star Methods Rbns Primers Idt Star Methods Recombinant Dna Px458 Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+star+software+package+lasergene/pm41932309-792-83-97?v=Addgene+inc Average 96 stars, based on 1 article reviews
crispr cas9 genomic engineering idt star methods rbns primers idt star methods recombinant dna px458 addgene plasmid - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
Thermo Fisher
phusion hot start ii dna polymerase ![]() Phusion Hot Start Ii Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+star+software+package+lasergene/pmc10545912-265-3-9?v=Thermo+Fisher Average 99 stars, based on 1 article reviews
phusion hot start ii dna polymerase - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
New England Biolabs
q5 hot start high fidelity dna polymerase ![]() Q5 Hot Start High Fidelity Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+star+software+package+lasergene/pmc06996002-455-5-11?v=New+England+Biolabs Average 99 stars, based on 1 article reviews
q5 hot start high fidelity dna polymerase - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
Tree Star Inc
cgtgggaaaggagatggttgtg ![]() Cgtgggaaaggagatggttgtg, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+star+software+package+lasergene/pm31079916-284-221-249?v=Tree+Star+Inc Average 86 stars, based on 1 article reviews
cgtgggaaaggagatggttgtg - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
DNASTAR
seqman software ![]() Seqman Software, supplied by DNASTAR, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+star+software+package+lasergene/pm37372406-44-11-16?v=DNASTAR Average 97 stars, based on 1 article reviews
seqman software - by Bioz Stars,
2026-08
97/100 stars
|
Buy from Supplier |
|
New England Biolabs
taq dna polymerase ![]() Taq Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+star+software+package+lasergene/pmc11270466-114-25-46?v=New+England+Biolabs Average 99 stars, based on 1 article reviews
taq dna polymerase - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
Carl Zeiss
lsm 510 software ![]() Lsm 510 Software, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+star+software+package+lasergene/pm29033323-213-177-194?v=Carl+Zeiss Average 90 stars, based on 1 article reviews
lsm 510 software - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Addgene inc
rt pcr primers n a n a recombinant dna mscv ires thy1 1 addgene plasmid id ![]() Rt Pcr Primers N A N A Recombinant Dna Mscv Ires Thy1 1 Addgene Plasmid Id, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+star+software+package+lasergene/pm34644558-221-25-32?v=Addgene+inc Average 93 stars, based on 1 article reviews
rt pcr primers n a n a recombinant dna mscv ires thy1 1 addgene plasmid id - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Scientific Reports
Article Title: ATP sulfurylase atypical leucine zipper interacts with Cys3 and calcineurin A in the regulation of sulfur amino acid biosynthesis in Cryptococcus neoformans
doi: 10.1038/s41598-023-37556-5
Figure Lengend Snippet: Domains and motifs of ATP sulfurylase in various organisms. ( A ) Schematic representation of the domains present in ATP sulfurylase in C. neoformans (CNAG_04215), A. fumigatus (Afu3g06530), N. crassa (NCU01985), S. cerevisiae (YJR010W), C. albicans (CAWG_00065), H. sapiens (AAC64583), and A. thaliana (AAB09473). The numbers indicate the position of the domains. ATP sulfurylase domain is in green, APS kinase in blue, and leucine zipper in red. Image was generated by DOG 1.0: Illustrator of Protein Domain Structures software . ( B ) Alignment of the amino acid sequence of the putative leucine zipper found at the N-terminus of the ATP sulfurylase in various organisms; the four conserved leucine/isoleucine separated by any of the six amino acids are boxed in blue and indicated by asterisk. The putative PxIxIT motif in C. neoformans is highlighted in pink. The alignment was generated by MegaAlign Software Lasergene (DNA Star).
Article Snippet: The alignment was generated by
Techniques: Generated, Software, Sequencing
Journal: Cell Reports Methods
Article Title: A genomic platform for surveillance and antigen discovery in Plasmodium spp. using long-read amplicon sequencing
doi: 10.1016/j.crmeth.2023.100574
Figure Lengend Snippet:
Article Snippet: Six units of
Techniques: Recombinant, Purification, Amplification, Software
Journal: Cell Reports
Article Title: Chronic Viral Infection Promotes Efficient Germinal Center B Cell Responses
doi: 10.1016/j.celrep.2019.12.023
Figure Lengend Snippet:
Article Snippet: PCR- amplification was performed with
Techniques: Plasmid Preparation, Recombinant, Antibody Labeling, Cell Isolation, Clone Assay, Sequencing, Expressing, Software
Journal: NAR Cancer
Article Title: DNA abasic sites act as rational therapeutic targets to synergize temozolomide response in both MMR-proficient and deficient cancer
doi: 10.1093/narcan/zcae034
Figure Lengend Snippet: RA-1 impairs the BER pathway, leading to DNA double-strand breaks in the TMZ-RA1 combination. ( A ) In vitro reconstitution of the BER pathway utilized 22-UC AP-DNA oligonucleotide with Taq DNA Polymerase (0.2 U/μl), dNTP (200 μM), APE1 (0.2 U/μl), and Ligase (0.25 U/μl), along with RA-1 (50 μM). Lane designations are lane 1: 22UC with intact Uracil, lane 2: AP-DNA (22AP) oligonucleotide, lane 3: RA-1 cleavage of AP-DNA, lane 4: AP-DNA cleavage mediated by RA-1 with Taq DNA Pol, dNTPs, and with combination T4 DNA ligase (in lane 5), lane 6: APE1-mediated cleavage of 22-AP, lane 7: APE1-mediated cleavage with Taq DNA Pol, dNTPs, and with combination T4 DNA ligase (in lane 8), lane 9: AP-DNA cleavage with RA-1 and all enzymes, lane 10: AP-DNA cleavage with RA-1 and APE1. (The a–k band is depicted according to shown in ). ( B ) Neutral comet assays were conducted to detect DNA DSBs following treatment with TMZ (100 μM) and RA-1 (5 μM) either independently or in combination ( TMZ-RA1 ) in both MMR-proficient and deficient cancer cells. Representative images of comets are shown (scale bar = 10 μM). ( C ) The relative tail moment of DNA after treatment is presented for both MMR-proficient and deficient cancer cells. ( D ) Representative image of γH2AX foci (red) in both MMR-proficient and deficient cancer cells after treatment with TMZ (100 μM) and RA-1 (5 μM) independently or in combination ( TMZ-RA1 ). Hoechst staining (blue) was used to label the cell nucleus (scale bar = 10 μM) . (E ) The percentage of cells with γH2AX foci (>10 foci per cell) in both MMR-proficient and MMR-deficient cancer cells. ( F ) The phosphorylated ATM relative fluorescence intensity per nucleus was quantified using ImageJ software in both MMR-proficient and MMR-deficient cancer cells . For (C), (E) and (F), the data was statistically analyzed by one-way ANOVA followed by Tukey's for the multiple group comparison using GraphPad Prism 9.2.0. The criteria for the statistical significance followed as (ns) ‘not significant’, P ≤ 0.033 (*), P ≤ 0.002(**) and P ≤ 0.001 (***).
Article Snippet: In a typical 20 μl reaction mixture, 250 nM AP-DNA (22-AP) was incubated overnight at 37°C with or without RA-1 (50 μM), APE1 (0.2 U/μl),
Techniques: In Vitro, Staining, Fluorescence, Software, Comparison