dna star software package lasergene Search Results


99
DNASTAR megalign
Megalign, supplied by DNASTAR, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+star+software+package+lasergene/pm39794745-59-1-7?v=DNASTAR
Average 99 stars, based on 1 article reviews
megalign - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
DNASTAR megaalign software lasergene
Domains and motifs of ATP sulfurylase in various organisms. ( A ) Schematic representation of the domains present in ATP sulfurylase in C. neoformans (CNAG_04215), A. fumigatus (Afu3g06530), N. crassa (NCU01985), S. cerevisiae (YJR010W), C. albicans (CAWG_00065), H. sapiens (AAC64583), and A. thaliana (AAB09473). The numbers indicate the position of the domains. ATP sulfurylase domain is in green, APS kinase in blue, and leucine zipper in red. Image was generated by DOG 1.0: Illustrator of Protein Domain Structures software . ( B ) Alignment of the amino acid sequence of the putative leucine zipper found at the N-terminus of the ATP sulfurylase in various organisms; the four conserved leucine/isoleucine separated by any of the six amino acids are boxed in blue and indicated by asterisk. The putative PxIxIT motif in C. neoformans is highlighted in pink. The alignment was generated by <t>MegaAlign</t> Software <t>Lasergene</t> (DNA Star).
Megaalign Software Lasergene, supplied by DNASTAR, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+star+software+package+lasergene/pmc10359356-105-5-7?v=DNASTAR
Average 99 stars, based on 1 article reviews
megaalign software lasergene - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

90
GraphPad Software Inc graphpad prism 7
Domains and motifs of ATP sulfurylase in various organisms. ( A ) Schematic representation of the domains present in ATP sulfurylase in C. neoformans (CNAG_04215), A. fumigatus (Afu3g06530), N. crassa (NCU01985), S. cerevisiae (YJR010W), C. albicans (CAWG_00065), H. sapiens (AAC64583), and A. thaliana (AAB09473). The numbers indicate the position of the domains. ATP sulfurylase domain is in green, APS kinase in blue, and leucine zipper in red. Image was generated by DOG 1.0: Illustrator of Protein Domain Structures software . ( B ) Alignment of the amino acid sequence of the putative leucine zipper found at the N-terminus of the ATP sulfurylase in various organisms; the four conserved leucine/isoleucine separated by any of the six amino acids are boxed in blue and indicated by asterisk. The putative PxIxIT motif in C. neoformans is highlighted in pink. The alignment was generated by <t>MegaAlign</t> Software <t>Lasergene</t> (DNA Star).
Graphpad Prism 7, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+star+software+package+lasergene/pm31079916-285-235-235?v=GraphPad+Software+Inc
Average 90 stars, based on 1 article reviews
graphpad prism 7 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

96
Addgene inc crispr cas9 genomic engineering idt star methods rbns primers idt star methods recombinant dna px458 addgene plasmid
Domains and motifs of ATP sulfurylase in various organisms. ( A ) Schematic representation of the domains present in ATP sulfurylase in C. neoformans (CNAG_04215), A. fumigatus (Afu3g06530), N. crassa (NCU01985), S. cerevisiae (YJR010W), C. albicans (CAWG_00065), H. sapiens (AAC64583), and A. thaliana (AAB09473). The numbers indicate the position of the domains. ATP sulfurylase domain is in green, APS kinase in blue, and leucine zipper in red. Image was generated by DOG 1.0: Illustrator of Protein Domain Structures software . ( B ) Alignment of the amino acid sequence of the putative leucine zipper found at the N-terminus of the ATP sulfurylase in various organisms; the four conserved leucine/isoleucine separated by any of the six amino acids are boxed in blue and indicated by asterisk. The putative PxIxIT motif in C. neoformans is highlighted in pink. The alignment was generated by <t>MegaAlign</t> Software <t>Lasergene</t> (DNA Star).
Crispr Cas9 Genomic Engineering Idt Star Methods Rbns Primers Idt Star Methods Recombinant Dna Px458 Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+star+software+package+lasergene/pm41932309-792-83-97?v=Addgene+inc
Average 96 stars, based on 1 article reviews
crispr cas9 genomic engineering idt star methods rbns primers idt star methods recombinant dna px458 addgene plasmid - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

99
Thermo Fisher phusion hot start ii dna polymerase

Phusion Hot Start Ii Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+star+software+package+lasergene/pmc10545912-265-3-9?v=Thermo+Fisher
Average 99 stars, based on 1 article reviews
phusion hot start ii dna polymerase - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
New England Biolabs q5 hot start high fidelity dna polymerase

Q5 Hot Start High Fidelity Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+star+software+package+lasergene/pmc06996002-455-5-11?v=New+England+Biolabs
Average 99 stars, based on 1 article reviews
q5 hot start high fidelity dna polymerase - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

86
Tree Star Inc cgtgggaaaggagatggttgtg

Cgtgggaaaggagatggttgtg, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+star+software+package+lasergene/pm31079916-284-221-249?v=Tree+Star+Inc
Average 86 stars, based on 1 article reviews
cgtgggaaaggagatggttgtg - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

97
DNASTAR seqman software

Seqman Software, supplied by DNASTAR, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+star+software+package+lasergene/pm37372406-44-11-16?v=DNASTAR
Average 97 stars, based on 1 article reviews
seqman software - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier

99
New England Biolabs taq dna polymerase
RA-1 impairs the BER pathway, leading to <t>DNA</t> double-strand breaks in the TMZ-RA1 combination. ( A ) In vitro reconstitution of the BER pathway utilized 22-UC AP-DNA oligonucleotide with Taq DNA <t>Polymerase</t> (0.2 U/μl), dNTP (200 μM), APE1 (0.2 U/μl), and Ligase (0.25 U/μl), along with RA-1 (50 μM). Lane designations are lane 1: 22UC with intact Uracil, lane 2: AP-DNA (22AP) oligonucleotide, lane 3: RA-1 cleavage of AP-DNA, lane 4: AP-DNA cleavage mediated by RA-1 with Taq DNA Pol, dNTPs, and with combination T4 DNA ligase (in lane 5), lane 6: APE1-mediated cleavage of 22-AP, lane 7: APE1-mediated cleavage with Taq DNA Pol, dNTPs, and with combination T4 DNA ligase (in lane 8), lane 9: AP-DNA cleavage with RA-1 and all enzymes, lane 10: AP-DNA cleavage with RA-1 and APE1. (The a–k band is depicted according to shown in ). ( B ) Neutral comet assays were conducted to detect DNA DSBs following treatment with TMZ (100 μM) and RA-1 (5 μM) either independently or in combination ( TMZ-RA1 ) in both MMR-proficient and deficient cancer cells. Representative images of comets are shown (scale bar = 10 μM). ( C ) The relative tail moment of DNA after treatment is presented for both MMR-proficient and deficient cancer cells. ( D ) Representative image of γH2AX foci (red) in both MMR-proficient and deficient cancer cells after treatment with TMZ (100 μM) and RA-1 (5 μM) independently or in combination ( TMZ-RA1 ). Hoechst staining (blue) was used to label the cell nucleus (scale bar = 10 μM) . (E ) The percentage of cells with γH2AX foci (>10 foci per cell) in both MMR-proficient and MMR-deficient cancer cells. ( F ) The phosphorylated ATM relative fluorescence intensity per nucleus was quantified using ImageJ software in both MMR-proficient and MMR-deficient cancer cells . For (C), (E) and (F), the data was statistically analyzed by one-way ANOVA followed by Tukey's for the multiple group comparison using GraphPad Prism 9.2.0. The criteria for the statistical significance followed as (ns) ‘not significant’, P ≤ 0.033 (*), P ≤ 0.002(**) and P ≤ 0.001 (***).
Taq Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+star+software+package+lasergene/pmc11270466-114-25-46?v=New+England+Biolabs
Average 99 stars, based on 1 article reviews
taq dna polymerase - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

90
Carl Zeiss lsm 510 software
RA-1 impairs the BER pathway, leading to <t>DNA</t> double-strand breaks in the TMZ-RA1 combination. ( A ) In vitro reconstitution of the BER pathway utilized 22-UC AP-DNA oligonucleotide with Taq DNA <t>Polymerase</t> (0.2 U/μl), dNTP (200 μM), APE1 (0.2 U/μl), and Ligase (0.25 U/μl), along with RA-1 (50 μM). Lane designations are lane 1: 22UC with intact Uracil, lane 2: AP-DNA (22AP) oligonucleotide, lane 3: RA-1 cleavage of AP-DNA, lane 4: AP-DNA cleavage mediated by RA-1 with Taq DNA Pol, dNTPs, and with combination T4 DNA ligase (in lane 5), lane 6: APE1-mediated cleavage of 22-AP, lane 7: APE1-mediated cleavage with Taq DNA Pol, dNTPs, and with combination T4 DNA ligase (in lane 8), lane 9: AP-DNA cleavage with RA-1 and all enzymes, lane 10: AP-DNA cleavage with RA-1 and APE1. (The a–k band is depicted according to shown in ). ( B ) Neutral comet assays were conducted to detect DNA DSBs following treatment with TMZ (100 μM) and RA-1 (5 μM) either independently or in combination ( TMZ-RA1 ) in both MMR-proficient and deficient cancer cells. Representative images of comets are shown (scale bar = 10 μM). ( C ) The relative tail moment of DNA after treatment is presented for both MMR-proficient and deficient cancer cells. ( D ) Representative image of γH2AX foci (red) in both MMR-proficient and deficient cancer cells after treatment with TMZ (100 μM) and RA-1 (5 μM) independently or in combination ( TMZ-RA1 ). Hoechst staining (blue) was used to label the cell nucleus (scale bar = 10 μM) . (E ) The percentage of cells with γH2AX foci (>10 foci per cell) in both MMR-proficient and MMR-deficient cancer cells. ( F ) The phosphorylated ATM relative fluorescence intensity per nucleus was quantified using ImageJ software in both MMR-proficient and MMR-deficient cancer cells . For (C), (E) and (F), the data was statistically analyzed by one-way ANOVA followed by Tukey's for the multiple group comparison using GraphPad Prism 9.2.0. The criteria for the statistical significance followed as (ns) ‘not significant’, P ≤ 0.033 (*), P ≤ 0.002(**) and P ≤ 0.001 (***).
Lsm 510 Software, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+star+software+package+lasergene/pm29033323-213-177-194?v=Carl+Zeiss
Average 90 stars, based on 1 article reviews
lsm 510 software - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

93
Addgene inc rt pcr primers n a n a recombinant dna mscv ires thy1 1 addgene plasmid id
RA-1 impairs the BER pathway, leading to <t>DNA</t> double-strand breaks in the TMZ-RA1 combination. ( A ) In vitro reconstitution of the BER pathway utilized 22-UC AP-DNA oligonucleotide with Taq DNA <t>Polymerase</t> (0.2 U/μl), dNTP (200 μM), APE1 (0.2 U/μl), and Ligase (0.25 U/μl), along with RA-1 (50 μM). Lane designations are lane 1: 22UC with intact Uracil, lane 2: AP-DNA (22AP) oligonucleotide, lane 3: RA-1 cleavage of AP-DNA, lane 4: AP-DNA cleavage mediated by RA-1 with Taq DNA Pol, dNTPs, and with combination T4 DNA ligase (in lane 5), lane 6: APE1-mediated cleavage of 22-AP, lane 7: APE1-mediated cleavage with Taq DNA Pol, dNTPs, and with combination T4 DNA ligase (in lane 8), lane 9: AP-DNA cleavage with RA-1 and all enzymes, lane 10: AP-DNA cleavage with RA-1 and APE1. (The a–k band is depicted according to shown in ). ( B ) Neutral comet assays were conducted to detect DNA DSBs following treatment with TMZ (100 μM) and RA-1 (5 μM) either independently or in combination ( TMZ-RA1 ) in both MMR-proficient and deficient cancer cells. Representative images of comets are shown (scale bar = 10 μM). ( C ) The relative tail moment of DNA after treatment is presented for both MMR-proficient and deficient cancer cells. ( D ) Representative image of γH2AX foci (red) in both MMR-proficient and deficient cancer cells after treatment with TMZ (100 μM) and RA-1 (5 μM) independently or in combination ( TMZ-RA1 ). Hoechst staining (blue) was used to label the cell nucleus (scale bar = 10 μM) . (E ) The percentage of cells with γH2AX foci (>10 foci per cell) in both MMR-proficient and MMR-deficient cancer cells. ( F ) The phosphorylated ATM relative fluorescence intensity per nucleus was quantified using ImageJ software in both MMR-proficient and MMR-deficient cancer cells . For (C), (E) and (F), the data was statistically analyzed by one-way ANOVA followed by Tukey's for the multiple group comparison using GraphPad Prism 9.2.0. The criteria for the statistical significance followed as (ns) ‘not significant’, P ≤ 0.033 (*), P ≤ 0.002(**) and P ≤ 0.001 (***).
Rt Pcr Primers N A N A Recombinant Dna Mscv Ires Thy1 1 Addgene Plasmid Id, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+star+software+package+lasergene/pm34644558-221-25-32?v=Addgene+inc
Average 93 stars, based on 1 article reviews
rt pcr primers n a n a recombinant dna mscv ires thy1 1 addgene plasmid id - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

Image Search Results


Domains and motifs of ATP sulfurylase in various organisms. ( A ) Schematic representation of the domains present in ATP sulfurylase in C. neoformans (CNAG_04215), A. fumigatus (Afu3g06530), N. crassa (NCU01985), S. cerevisiae (YJR010W), C. albicans (CAWG_00065), H. sapiens (AAC64583), and A. thaliana (AAB09473). The numbers indicate the position of the domains. ATP sulfurylase domain is in green, APS kinase in blue, and leucine zipper in red. Image was generated by DOG 1.0: Illustrator of Protein Domain Structures software . ( B ) Alignment of the amino acid sequence of the putative leucine zipper found at the N-terminus of the ATP sulfurylase in various organisms; the four conserved leucine/isoleucine separated by any of the six amino acids are boxed in blue and indicated by asterisk. The putative PxIxIT motif in C. neoformans is highlighted in pink. The alignment was generated by MegaAlign Software Lasergene (DNA Star).

Journal: Scientific Reports

Article Title: ATP sulfurylase atypical leucine zipper interacts with Cys3 and calcineurin A in the regulation of sulfur amino acid biosynthesis in Cryptococcus neoformans

doi: 10.1038/s41598-023-37556-5

Figure Lengend Snippet: Domains and motifs of ATP sulfurylase in various organisms. ( A ) Schematic representation of the domains present in ATP sulfurylase in C. neoformans (CNAG_04215), A. fumigatus (Afu3g06530), N. crassa (NCU01985), S. cerevisiae (YJR010W), C. albicans (CAWG_00065), H. sapiens (AAC64583), and A. thaliana (AAB09473). The numbers indicate the position of the domains. ATP sulfurylase domain is in green, APS kinase in blue, and leucine zipper in red. Image was generated by DOG 1.0: Illustrator of Protein Domain Structures software . ( B ) Alignment of the amino acid sequence of the putative leucine zipper found at the N-terminus of the ATP sulfurylase in various organisms; the four conserved leucine/isoleucine separated by any of the six amino acids are boxed in blue and indicated by asterisk. The putative PxIxIT motif in C. neoformans is highlighted in pink. The alignment was generated by MegaAlign Software Lasergene (DNA Star).

Article Snippet: The alignment was generated by MegaAlign Software Lasergene (DNA Star).

Techniques: Generated, Software, Sequencing

Journal: Cell Reports Methods

Article Title: A genomic platform for surveillance and antigen discovery in Plasmodium spp. using long-read amplicon sequencing

doi: 10.1016/j.crmeth.2023.100574

Figure Lengend Snippet:

Article Snippet: Six units of Phusion Hot Start II DNA Polymerase (Thermo Scientific), 1x Phusion HF Buffer (Thermo Scientific), 200μM dNTP mix (Thermo Scientific), 0.5μM msp2_fw, 0.5μM msp2_rv2 and 1μL purified DNA were mixed in individual wells of 96-well PCR plates.

Techniques: Recombinant, Purification, Amplification, Software

Journal: Cell Reports

Article Title: Chronic Viral Infection Promotes Efficient Germinal Center B Cell Responses

doi: 10.1016/j.celrep.2019.12.023

Figure Lengend Snippet:

Article Snippet: PCR- amplification was performed with Q5 Hot Start High-Fidelity DNA polymerase (NEB) in 50 μL reaction volumes with adjusted cycle numbers.

Techniques: Plasmid Preparation, Recombinant, Antibody Labeling, Cell Isolation, Clone Assay, Sequencing, Expressing, Software

RA-1 impairs the BER pathway, leading to DNA double-strand breaks in the TMZ-RA1 combination. ( A ) In vitro reconstitution of the BER pathway utilized 22-UC AP-DNA oligonucleotide with Taq DNA Polymerase (0.2 U/μl), dNTP (200 μM), APE1 (0.2 U/μl), and Ligase (0.25 U/μl), along with RA-1 (50 μM). Lane designations are lane 1: 22UC with intact Uracil, lane 2: AP-DNA (22AP) oligonucleotide, lane 3: RA-1 cleavage of AP-DNA, lane 4: AP-DNA cleavage mediated by RA-1 with Taq DNA Pol, dNTPs, and with combination T4 DNA ligase (in lane 5), lane 6: APE1-mediated cleavage of 22-AP, lane 7: APE1-mediated cleavage with Taq DNA Pol, dNTPs, and with combination T4 DNA ligase (in lane 8), lane 9: AP-DNA cleavage with RA-1 and all enzymes, lane 10: AP-DNA cleavage with RA-1 and APE1. (The a–k band is depicted according to shown in ). ( B ) Neutral comet assays were conducted to detect DNA DSBs following treatment with TMZ (100 μM) and RA-1 (5 μM) either independently or in combination ( TMZ-RA1 ) in both MMR-proficient and deficient cancer cells. Representative images of comets are shown (scale bar = 10 μM). ( C ) The relative tail moment of DNA after treatment is presented for both MMR-proficient and deficient cancer cells. ( D ) Representative image of γH2AX foci (red) in both MMR-proficient and deficient cancer cells after treatment with TMZ (100 μM) and RA-1 (5 μM) independently or in combination ( TMZ-RA1 ). Hoechst staining (blue) was used to label the cell nucleus (scale bar = 10 μM) . (E ) The percentage of cells with γH2AX foci (>10 foci per cell) in both MMR-proficient and MMR-deficient cancer cells. ( F ) The phosphorylated ATM relative fluorescence intensity per nucleus was quantified using ImageJ software in both MMR-proficient and MMR-deficient cancer cells . For (C), (E) and (F), the data was statistically analyzed by one-way ANOVA followed by Tukey's for the multiple group comparison using GraphPad Prism 9.2.0. The criteria for the statistical significance followed as (ns) ‘not significant’, P ≤ 0.033 (*), P ≤ 0.002(**) and P ≤ 0.001 (***).

Journal: NAR Cancer

Article Title: DNA abasic sites act as rational therapeutic targets to synergize temozolomide response in both MMR-proficient and deficient cancer

doi: 10.1093/narcan/zcae034

Figure Lengend Snippet: RA-1 impairs the BER pathway, leading to DNA double-strand breaks in the TMZ-RA1 combination. ( A ) In vitro reconstitution of the BER pathway utilized 22-UC AP-DNA oligonucleotide with Taq DNA Polymerase (0.2 U/μl), dNTP (200 μM), APE1 (0.2 U/μl), and Ligase (0.25 U/μl), along with RA-1 (50 μM). Lane designations are lane 1: 22UC with intact Uracil, lane 2: AP-DNA (22AP) oligonucleotide, lane 3: RA-1 cleavage of AP-DNA, lane 4: AP-DNA cleavage mediated by RA-1 with Taq DNA Pol, dNTPs, and with combination T4 DNA ligase (in lane 5), lane 6: APE1-mediated cleavage of 22-AP, lane 7: APE1-mediated cleavage with Taq DNA Pol, dNTPs, and with combination T4 DNA ligase (in lane 8), lane 9: AP-DNA cleavage with RA-1 and all enzymes, lane 10: AP-DNA cleavage with RA-1 and APE1. (The a–k band is depicted according to shown in ). ( B ) Neutral comet assays were conducted to detect DNA DSBs following treatment with TMZ (100 μM) and RA-1 (5 μM) either independently or in combination ( TMZ-RA1 ) in both MMR-proficient and deficient cancer cells. Representative images of comets are shown (scale bar = 10 μM). ( C ) The relative tail moment of DNA after treatment is presented for both MMR-proficient and deficient cancer cells. ( D ) Representative image of γH2AX foci (red) in both MMR-proficient and deficient cancer cells after treatment with TMZ (100 μM) and RA-1 (5 μM) independently or in combination ( TMZ-RA1 ). Hoechst staining (blue) was used to label the cell nucleus (scale bar = 10 μM) . (E ) The percentage of cells with γH2AX foci (>10 foci per cell) in both MMR-proficient and MMR-deficient cancer cells. ( F ) The phosphorylated ATM relative fluorescence intensity per nucleus was quantified using ImageJ software in both MMR-proficient and MMR-deficient cancer cells . For (C), (E) and (F), the data was statistically analyzed by one-way ANOVA followed by Tukey's for the multiple group comparison using GraphPad Prism 9.2.0. The criteria for the statistical significance followed as (ns) ‘not significant’, P ≤ 0.033 (*), P ≤ 0.002(**) and P ≤ 0.001 (***).

Article Snippet: In a typical 20 μl reaction mixture, 250 nM AP-DNA (22-AP) was incubated overnight at 37°C with or without RA-1 (50 μM), APE1 (0.2 U/μl), Taq DNA Polymerase (0.2 U/μl), and dNTPs (200 μM each of dATP, dCTP, dGTP, and dTTP) in Tris Buffer containing 1× NEB Buffer (10 mM MgCl 2 ) ( ).

Techniques: In Vitro, Staining, Fluorescence, Software, Comparison